| Primary Identifier | MGI:6491614 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ythdf2 |
| Transmission | Germline | Strain of Origin | (C57BL/6 x 129S4/SvJae)F1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Exon 3 was targeted with sgRNAs (targeting CTTACTTGAGCCCACAGGCA and ACAGAACCATTTTGTACTAG) using CRISPR/Cas9 technology, resulting in a 44 bp deletion. This allele occurs in conjunction with the HREF="http://www.informatics.jax.org/allele/MGI:6491613">Ythdf1em1Jhha, Ythdf1em3Jhha and Ythdf3em1Jhha alleles in the same ESC line. |
