| Primary Identifier | MGI:6491615 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ythdf3 |
| Transmission | Germline | Strain of Origin | (C57BL/6 x 129S4/SvJae)F1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The 5' end of exon 4 was targeted with sgRNAs (targeting ATTGGATTTCCATATTCTCT and ATATATGGATCTGACATTGG) using CRISPR/Cas9 technology, resulting in a 40 bp deletion. This allele occurs in conjunction with the Ythdf1em1Jhha, Ythdf1em3Jhha and Ythdf2em1Jhha alleles in the same ESC line. |
