|  Help  |  About  |  Contact Us

Allele : Ythdf1<em3Jhha> YTH N6-methyladenosine RNA binding protein 1; endonuclease-mediated mutation 3, Jacob Hanna

Primary Identifier  MGI:6491621 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ythdf1
Strain of Origin  (C57BL/6 x 129S4/SvJae)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  The 5' end of exon 4 was targeted with sgRNAs (targeting ATTTCCTTACTCCCTCAGCG and GGATAGTAACTGGACAGGTA) using CRISPR/Cas9 technology, resulting in a 59 bp deletion. This allele occurs in conjunction with the Ythdf1em1Jhha, Ythdf2em1Jhha and Ythdf3em1Jhha alleles in the same ESC line.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories