| Primary Identifier | MGI:6491621 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ythdf1 |
| Strain of Origin | (C57BL/6 x 129S4/SvJae)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The 5' end of exon 4 was targeted with sgRNAs (targeting ATTTCCTTACTCCCTCAGCG and GGATAGTAACTGGACAGGTA) using CRISPR/Cas9 technology, resulting in a 59 bp deletion. This allele occurs in conjunction with the Ythdf1em1Jhha, Ythdf2em1Jhha and Ythdf3em1Jhha alleles in the same ESC line. |
