| Primary Identifier | MGI:6515598 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Vcpip1 |
| Strain of Origin | C57BL/6NHsd | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The gene was targeted with a crRNA/tracrRNA duplex (targeting TTCGGTCCCTTCGTTTCGAA) and an ssODN template (CCGGAAAGGATTCTTCGGTCCCTTCGTTTCCTACAACAGCTTAATTAAGGTTTAAACGCCATGACGAAAGGCCCCCCGGAGAAGCCGCCGCCGCCAGAGA) using CRISPR/Cas9 technology, resulting in the creation of premature stop codons in all three reading frames. Peptide expression from this alleles was absent from mouse embryo fibroblasts (MEFs). |
