| Primary Identifier | MGI:6690242 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Syngr3 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exon 2 was targeted with a gRNA (targeting TTCGGACCGATTGTCAACGA) and an ssODN that introduces stop codons in all three reading frames (TAACTAGATGA), using CRISPR/Cas9 technology. Immunochemistry experiments confirmed the lack of peptide expression from this allele in the brain. |
