|  Help  |  About  |  Contact Us

Allele : Syngr3<em1Pave> synaptogyrin 3; endonuclease-mediated mutation 1, Patrik Verstreken

Primary Identifier  MGI:6690242 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Syngr3
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 2 was targeted with a gRNA (targeting TTCGGACCGATTGTCAACGA) and an ssODN that introduces stop codons in all three reading frames (TAACTAGATGA), using CRISPR/Cas9 technology. Immunochemistry experiments confirmed the lack of peptide expression from this allele in the brain.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • synaptogyrin-3<->,
  • synaptogyrin-3<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories