|  Help  |  About  |  Contact Us

Allele : Myh7b<em1Eno> myosin, heavy chain 7B, cardiac muscle, beta; endonuclease-mediated mutation 1, Eric N Olson

Primary Identifier  MGI:6712699 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Myh7b
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 2 was targeted with an sgRNA (targeting TGATGGATATGAGTGAACTTGG) and an ssODN containing three poly(A) signals flanked by homology arms using CRISPR/Cas9 technology. In the resulting allele transcription is disrupted by the insertion of premature poly(A) signals in exon 2.
  • mutations:
  • Insertion
  • synonyms:
  • MYH7b null,
  • MYH7b null
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories