| Primary Identifier | MGI:6712699 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Myh7b |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exon 2 was targeted with an sgRNA (targeting TGATGGATATGAGTGAACTTGG) and an ssODN containing three poly(A) signals flanked by homology arms using CRISPR/Cas9 technology. In the resulting allele transcription is disrupted by the insertion of premature poly(A) signals in exon 2. |
