| Primary Identifier | MGI:6712815 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp750 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, TCAGTGCTATGGCTAGAGAG and GACTCATTATCCTTTGTGTT, which resulted in a 2279 bp deletion beginning at Chromosome 11 position 121,402,605 bp and ending after 121,404,883 bp (GRCm39). This mutation deletes 1431 bp of ENSMUSE00000307208 exon 2, 127 bp of intron 2-3 and 721 bp of ENSMUSE00000367226 exon 3 including the splice acceptor, start site splice donor and termination codon. This allele is predicted to be a null. |
