|  Help  |  About  |  Contact Us

Allele : Zfp750<em1(IMPC)J> zinc finger protein 750; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6712815 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp750
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, TCAGTGCTATGGCTAGAGAG and GACTCATTATCCTTTGTGTT, which resulted in a 2279 bp deletion beginning at Chromosome 11 position 121,402,605 bp and ending after 121,404,883 bp (GRCm39). This mutation deletes 1431 bp of ENSMUSE00000307208 exon 2, 127 bp of intron 2-3 and 721 bp of ENSMUSE00000367226 exon 3 including the splice acceptor, start site splice donor and termination codon. This allele is predicted to be a null.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele