| Primary Identifier | MGI:6731053 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zcchc3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGCGTGGCGGGGCACTGA and CATGGCCACCGGCGGCGGAG, which resulted in a 1232 bp deletion beginning at Chromosome 2 position 152,255,469 bp and ending after 152,256,700 bp (GRCm39/mm39). This mutation deletes 1232 bp from ENSMUSE00000640007 (exon 1) from 2 nucleotides before the ATG start and 26 nucleotides after the TGA stop and should result in a null allele. |
