|  Help  |  About  |  Contact Us

Allele : Zcchc3<em1(IMPC)J> zinc finger, CCHC domain containing 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6731053 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zcchc3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGCGTGGCGGGGCACTGA and CATGGCCACCGGCGGCGGAG, which resulted in a 1232 bp deletion beginning at Chromosome 2 position 152,255,469 bp and ending after 152,256,700 bp (GRCm39/mm39). This mutation deletes 1232 bp from ENSMUSE00000640007 (exon 1) from 2 nucleotides before the ATG start and 26 nucleotides after the TGA stop and should result in a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele