| Primary Identifier | MGI:6714028 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ncoa7 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The entire coding region was targeted with sgRNAs targeting sequence upstream of the start codon and downstream of the stop codon (GCGCCCGGCGCCCTGACCGT, ACATGAGTTGGCGAGATCCC) using CRISPR/Cas9 technology, resulting in a 157,481 bp deletion. RT-PCR experiments confirmed the lack of transcription from this allele. |