| Primary Identifier | MGI:6727113 | Allele Type | Endonuclease-mediated |
| Attribute String | Dominant negative | Gene | Trpm3 |
| Inheritance Mode | Semidominant | Strain of Origin | C57BL/6J x CBA |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Isoleucine codon 65 in exon 4 was targeted with sgRNAs (targeting TGTTTCAGGCTCAGAAATCCNGG and ATAAAATGCTCTTTCAATCCNGG ) and an ssODN (ATGGGGGTCTTTGGTGCTCGGTATGATGTGAACACATTCTCTTTTATAAAATGCTCTTTCCATCCAAGACTTCTGAGCCTGAAACAAAACGAGAGAGAGAGAAAAAAAGATGAATATAAATTTTAAATCT ) using CRISPR/Cas9 technology, resulting in a T-to-G mutation (c.195T>G) that changes it to a methionine codon (p.I65M). This mutation mimics a mutation associated with early-onset or pediatric cataract in humans. |
