|  Help  |  About  |  Contact Us

Allele : Trpm3<em1Alsh> transient receptor potential cation channel, subfamily M, member 3; endonuclease-mediated mutation 1, Alan Shiels

Primary Identifier  MGI:6727113 Allele Type  Endonuclease-mediated
Attribute String  Dominant negative Gene  Trpm3
Inheritance Mode  Semidominant Strain of Origin  C57BL/6J x CBA
Is Recombinase  false Is Wild Type  false
molecularNote  Isoleucine codon 65 in exon 4 was targeted with sgRNAs (targeting TGTTTCAGGCTCAGAAATCCNGG and ATAAAATGCTCTTTCAATCCNGG ) and an ssODN (ATGGGGGTCTTTGGTGCTCGGTATGATGTGAACACATTCTCTTTTATAAAATGCTCTTTCCATCCAAGACTTCTGAGCCTGAAACAAAACGAGAGAGAGAGAAAAAAAGATGAATATAAATTTTAAATCT ) using CRISPR/Cas9 technology, resulting in a T-to-G mutation (c.195T>G) that changes it to a methionine codon (p.I65M). This mutation mimics a mutation associated with early-onset or pediatric cataract in humans.
  • mutations:
  • Single point mutation
  • synonyms:
  • Trpm3<M>,
  • Trpm3-mutant,
  • Trpm3<M>,
  • Trpm3-mutant
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories