| Primary Identifier | MGI:6725158 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pnldc1 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The last exon was targeted with an sgRNA (targeting CCATGCCCTGAGAGCAGTGAGCC) using CRISPR/Cas9 technology, resulting in a 1 bp insertion (A/T) 5 bp before the end of the stop codon. |
