|  Help  |  About  |  Contact Us

Allele : Cct8<em1(IMPC)J> chaperonin containing TCP1 subunit 8; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6836735 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cct8
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGATCTTACTTGAGTAAGG and AAGTGAAAGAGACGTGTACG, which resulted in a 4192 bp deletion beginning at Chromosome 16 position 87,284,234 bp and ending after 87,288,425 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001223260, ENSMUSE00001206188, ENSMUSE00001252459, ENSMUSE00001247901, ENSMUSE00001275047 (exons 4-8) and 3482 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 77 and early truncation 11 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Cct8<->,
  • Cct8<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

5 Publication categories