| Primary Identifier | MGI:6838377 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rnf126 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAAACCTCAGGGGTATCAG and CCAATGGTGAGGAAGCCATT, which resulted in a 587 bp deletion beginning at Chromosome 10 position 79,597,047 bp and ending after 79,597,633 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000316115 and ENSMUSE00000316109 (exons 5 and 6) and 448 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 148 and early truncation 92 amino acids later. |
