|  Help  |  About  |  Contact Us

Allele : Rnf126<em1(IMPC)J> ring finger protein 126; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6838377 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rnf126
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAAACCTCAGGGGTATCAG and CCAATGGTGAGGAAGCCATT, which resulted in a 587 bp deletion beginning at Chromosome 10 position 79,597,047 bp and ending after 79,597,633 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000316115 and ENSMUSE00000316109 (exons 5 and 6) and 448 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 148 and early truncation 92 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele