| Primary Identifier | MGI:6794050 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mob4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCACATTAACCGTGTATATG and TCTTCAGGAGATAAGCCCTT, which resulted in an 821 bp deletion beginning at Chromosome 1 position 55,187,235 bp and ending after 55,188,055 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001214175 (exon 4) and 778 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 10 amino acids later. |
