| Primary Identifier | MGI:6867238 | Allele Type | Endonuclease-mediated |
| Attribute String | Not Specified | Gene | Nexmif |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 genome editing used guide RNAs [ATCTTCCTGCATCAGAAGAG, AATTCGATATGAGTCCTTTC] to target exon 4. Donor DNAs were originally designed to introduce a R322X mutation. The resulting indel mutation was identified as an insertion of a G in exon 4 upstream of the intended mutation. |
