|  Help  |  About  |  Contact Us

Allele : Tpm1<em1Clo> tropomyosin 1, alpha; endonuclease-mediated mutation 1, Cecilia Lo

Primary Identifier  MGI:6879497 Allele Type  Endonuclease-mediated
Attribute String  Dominant negative, Humanized sequence, Null/knockout Gene  Tpm1
Strain of Origin  (C57BL/6 x DBA/2)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (CTTCTTGATGGCGTCCATGG) and an ssODN template (TCCGCTGCCTAAGGGCCCCTCGCCACCGCCACCATGGACGCCATCAAGAAGATGCAGATGCTGAAGCTCGACAAAGAGAACGCCTTGGATCGAGCTGAGCAAGCGGAGGCTGATAAGAAGGCGGC) with CRISPR/Cas9 technology, a mutation was engineered (deletion of one of lysine codons 5, 6 or 7 [p.K5del, p.K6del, p.K7del]) to mimic one linked to atrial septal defect (ASD) in human patients.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Tpm1<K5del>,
  • Tpm1<K5del>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories