| Primary Identifier | MGI:6879497 | Allele Type | Endonuclease-mediated |
| Attribute String | Dominant negative, Humanized sequence, Null/knockout | Gene | Tpm1 |
| Strain of Origin | (C57BL/6 x DBA/2)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using an sgRNA (CTTCTTGATGGCGTCCATGG) and an ssODN template (TCCGCTGCCTAAGGGCCCCTCGCCACCGCCACCATGGACGCCATCAAGAAGATGCAGATGCTGAAGCTCGACAAAGAGAACGCCTTGGATCGAGCTGAGCAAGCGGAGGCTGATAAGAAGGCGGC) with CRISPR/Cas9 technology, a mutation was engineered (deletion of one of lysine codons 5, 6 or 7 [p.K5del, p.K6del, p.K7del]) to mimic one linked to atrial septal defect (ASD) in human patients. |
