| Primary Identifier | MGI:6879498 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Tln2 |
| Inheritance Mode | Dominant | Strain of Origin | (C57BL/6 x DBA/2)F1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Using an sgRNA (AGGTGCGAACCAGAGCCTTG) and an ssODN template (CACCCCACCCTGCCCATACCCCTCCTTACCACCAAGACGTGTTCTAGTAGGTCCAGGTAGCCCAAGGTGCATTCTGTGCCATAATGCAAGGCTCTGGTTCGCACCTCTTCACTGACATCAGGGTA) with CRISPR/Cas9 technology, a mutation was engineered (arginine codon 2239 CGG to histidine CAT, p.R2239H) that mimics a human variant found to be protective for the atrial septal defect (ASD)-causing TPM1 p.K5del mutation in human patients. |
