|  Help  |  About  |  Contact Us

Allele : Epha2<em1Alsh> Eph receptor A2; endonuclease-mediated mutation 1, Alan Shiels

Primary Identifier  MGI:7256468 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Epha2
Is Recombinase  false Is Wild Type  false
molecularNote  Using sgRNAs (targeting GTTCAGTGTACTTCAGTTGGNGG and TTCAGTGTACTTCAGTTGGTNGG) and an SSODN template (GGCCAGGTCCCGGTGCACGTAGTTCATGTTGGCCAGGTACTTCATGCCGGATGCGATACCCTGCAGCATGCCCACTAGCTGAAGTACACTGAACTCACCATCCTTCTCCTGCAGAGATAGGCCCTCAGTGCTGACCGG) with CRISPR/Cas9 technology, arginine codon 722 (AGG) in exon 13 was changed to glutamine (CAG) (p.R722Q). The equivalent p.R721Q human mutation is associated with age-related cortical cataract.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Epha2-mutant,
  • Epha2-mutant
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories