|  Help  |  About  |  Contact Us

Allele : Spo11<em1Amp> SPO11 initiator of meiotic double stranded breaks; endonuclease-mediated mutation 1, Alberto M Pendas

Primary Identifier  MGI:7281852 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Spo11
Strain of Origin  (C57BL/6J x CBA/J)F2 Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/Cas9 technology, using sgRNAs (targeting TATGTCTCTATGCAGATGCA and ACACTGACAGCCAGCTCTTT) and an ssODN template, generated a TACTAC to TTCTTC change in exon 5, resulting in tyrosine to phenylalanine substitutions at amino acids 137 and 138 (p.Y112_Y113delinsFF), and inserted (duplicated) a T further downstream, leading to a frameshift and premature stop codon (p.Gly145Leufs*18).
  • mutations:
  • Nucleotide substitutions,
  • Insertion
  • synonyms:
  • Spo11<->,
  • Spo11<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories