| Primary Identifier | MGI:7281852 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Spo11 |
| Strain of Origin | (C57BL/6J x CBA/J)F2 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/Cas9 technology, using sgRNAs (targeting TATGTCTCTATGCAGATGCA and ACACTGACAGCCAGCTCTTT) and an ssODN template, generated a TACTAC to TTCTTC change in exon 5, resulting in tyrosine to phenylalanine substitutions at amino acids 137 and 138 (p.Y112_Y113delinsFF), and inserted (duplicated) a T further downstream, leading to a frameshift and premature stop codon (p.Gly145Leufs*18). |