|  Help  |  About  |  Contact Us

Allele : Lgals3bp<em2Lumc> lectin, galactoside-binding, soluble, 3 binding protein; endonuclease-mediated mutation 2, Leiden University Medical Centre

Primary Identifier  MGI:7331630 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready, No functional change Gene  Lgals3bp
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  This allele was generated by a 3' loxP site insertion in intron 5 via electroporation of C57BL/6J zygotes of CRISPR/Cas9 RNP (sgRNA sequence TTGTGACCATTTGTCTGCAA; chr11:118,287,207-118,287,226 GRCm39/mm39) and a loxP-containing ssDNA oligonucleotide (200bp). Subsequent CRISPR/Cas9-targeting with RNPs (sgRNA sequence CAATGTCCCGTTGCTAAGTG - Chr11:118289852-118289871 GRCm39/mm39) and a ssDNA oligonucleotide (200bp) inserted the 5' loxP site in intron 2, to generate the final conditional mouse model.
  • mutations:
  • Insertion
  • synonyms:
  • Lgals3bp-co,
  • Lgals3bp-fl,
  • Lgals3bp-co,
  • Lgals3bp-fl
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories