|  Help  |  About  |  Contact Us

Allele : Fmn1<em1Zllr> formin 1; endonuclease-mediated mutation 1, Rolf Zeller

Primary Identifier  MGI:7346402 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region, Null/knockout Gene  Fmn1
Is Recombinase  false Is Wild Type  false
molecularNote  An enhancer cluster containing Grem1 limb regulatory regions Rr285 (CRM2), Rr284 (CRM3) and Rr26 (CRM4), located in Fmn1 introns 15 and 13 [in reference to ENSMUST00000081349], was targeted with sgRNAs (targeting CACCGTGGCTTACCAGACTAGCGGT and CACCGAATGGTCTGATCGCCA) using CRISPR/Cas9 technology, resulting in a 71.2 kb deletion (chr2:113467121-113538319 GRCm39) from intron 13 to 16 (so including exons 14-16).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • EC1<delta>,
  • EC1<delta>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

3 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories