| Primary Identifier | MGI:7346403 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region, Null/knockout | Gene | Fmn1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | An enhancer cluster containing Grem1 limb regulatory regions Rr287 (CRM5) and Rr286 (CRM7), located in Fmn1 introns 12 and 6 [in reference to ENSMUST00000081349], was targeted with sgRNAs (targeting TTCAGCTGCATTGCGTCCTA and AGTCAAGGACACACGCTGTA) using CRISPR/Cas9 technology, resulting in a 34.3 kb deletion (chr2:113402655-113436919 GRCm39) from intron 6 to 12 (so including exons 7-12). |
