|  Help  |  About  |  Contact Us

Allele : Fmn1<em2Zllr> formin 1; endonuclease-mediated mutation 2, Rolf Zeller

Primary Identifier  MGI:7346403 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region, Null/knockout Gene  Fmn1
Is Recombinase  false Is Wild Type  false
molecularNote  An enhancer cluster containing Grem1 limb regulatory regions Rr287 (CRM5) and Rr286 (CRM7), located in Fmn1 introns 12 and 6 [in reference to ENSMUST00000081349], was targeted with sgRNAs (targeting TTCAGCTGCATTGCGTCCTA and AGTCAAGGACACACGCTGTA) using CRISPR/Cas9 technology, resulting in a 34.3 kb deletion (chr2:113402655-113436919 GRCm39) from intron 6 to 12 (so including exons 7-12).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • EC2<delta>,
  • EC2<delta>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

2 Mutation Involves

Trail: Allele

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele