| Primary Identifier | MGI:7366919 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region, Null/knockout | Gene | Nppb |
| Strain of Origin | FVB/NRj | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The potential Nppa/Nppb regulatory region upstream of Nppb was targeted with sgRNAs (targeting GGTTAATTGATTAAAAGTGG and GGGAATGCCTCAGCTACTGT) using CRISPR/Cas9 technology, resulting in the deletion of enhancer Rr93033 and the Nppb gene. |