|  Help  |  About  |  Contact Us

Allele : Nppb<em2Vmc> natriuretic peptide type B; endonuclease-mediated mutation 2, Vincent M Christoffels

Primary Identifier  MGI:7366920 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nppb
Strain of Origin  FVB/NRj Is Recombinase  false
Is Wild Type  false
molecularNote  The potential Nppa/Nppb regulatory region upstream of Nppb was targeted with sgRNAs (targeting GACTACATGGCAGATCACCC and GGGAATGCCTCAGCTACTGT) using CRISPR/Cas9 technology, resulting in the deletion of the Nppb gene.
  • mutations:
  • Intragenic deletion,
  • Intergenic deletion
  • synonyms:
  • RE3<->,
  • RE3<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories