| Primary Identifier | MGI:7428768 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tti1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTCAGCTCAAATGCCAAG and GTATAAGAGTTGTCCTGAGG, which resulted in a 4131 bp deletion beginning at Chromosome 2 position 157,996,891 bp and ending after 158,001,021 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001259605 and ENSMUSE00001282578 (exons 3 and 4) and 3793 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 766 and early truncation 36 amino acids later. |