|  Help  |  About  |  Contact Us

Allele : C2cd5<em1(IMPC)Tcp> C2 calcium-dependent domain containing 5; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:7464991 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  C2cd5
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATGCTGATGATGACTACTCG targeting the 5' side and ACTGCAGGTCGCCCTGTAGA targeting the 3' side of a critical region (ENSMUSE00000361445 and ENSMUSE00000374448). This resulted in a 3,009-bp deletion of Chr6 from 143023707 to 143026715 (GRCm39).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories