| Primary Identifier | MGI:7464991 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | C2cd5 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATGCTGATGATGACTACTCG targeting the 5' side and ACTGCAGGTCGCCCTGTAGA targeting the 3' side of a critical region (ENSMUSE00000361445 and ENSMUSE00000374448). This resulted in a 3,009-bp deletion of Chr6 from 143023707 to 143026715 (GRCm39). |
