|  Help  |  About  |  Contact Us

Allele : Grin2b<em1Weya> glutamate receptor, ionotropic, NMDA2B (epsilon 2); endonuclease-mediated mutation 1, Wei Yang

Primary Identifier  MGI:7449028 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Grin2b
Is Recombinase  false Is Wild Type  false
molecularNote  Tyrosine codon 1070 (TAT) was changed to phenylalanine (TTC) (p.Y1070F) through an AT>TC mutation in exon 14 or 15 (depending on splice variant) using an sgRNA (targeting TCCACGCATACTGTCACCTA) and ssODN template (ATCTCCACGCATACTGTCACCTTCGGCAAC) with CRISPR/Cas9 technology. This mutation prevents phosphorylation of the residue.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • GluN2B-Y1070F KI,
  • GluN2B-Y1070F KI
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories