| Primary Identifier | MGI:7449028 | Allele Type | Endonuclease-mediated |
| Attribute String | Not Specified | Gene | Grin2b |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Tyrosine codon 1070 (TAT) was changed to phenylalanine (TTC) (p.Y1070F) through an AT>TC mutation in exon 14 or 15 (depending on splice variant) using an sgRNA (targeting TCCACGCATACTGTCACCTA) and ssODN template (ATCTCCACGCATACTGTCACCTTCGGCAAC) with CRISPR/Cas9 technology. This mutation prevents phosphorylation of the residue. |
