| Primary Identifier | MGI:7465005 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tspyl5 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACCCCTACTCCGTCCGCTCA and CTGTGGTCCATCCGGTCAAG within exon ENSMUSE00000255842. This resulted in a 940bp deletion of Chr15 from 33687003 to 33687942 (GRCm39), introducing a frameshift and premature stop codon. |