|  Help  |  About  |  Contact Us

Allele : Nfil3<em1.1Kmm> nuclear factor, interleukin 3, regulated; endonuclease-mediated mutation 1.1, Kenneth M Murphy

Primary Identifier  MGI:7448469 Allele Type  Endonuclease-mediated
Attribute String  Reporter Gene  Nfil3
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (targeting GAAGATTTGCTCCTGAACGA) with CRISPR/Cas9 technology, the GFP fluorescent reporter gene was inserted upstream of the Nfil3 start site with a linker sequence (coding for GGSG) in-between, and a loxP site flanked neomycin resistance gene cassette was inserted 411 bp upstream of the Nfil3 coding sequence. The neo cassette was removed through subsequent Cre-mediated recombination. This allele expresses a chimeric GFP-Nfil3 peptide.
  • mutations:
  • Insertion
  • synonyms:
  • Nfil3<GFP>,
  • Nfil3<GFP>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories