| Primary Identifier | MGI:7448469 | Allele Type | Endonuclease-mediated |
| Attribute String | Reporter | Gene | Nfil3 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using an sgRNA (targeting GAAGATTTGCTCCTGAACGA) with CRISPR/Cas9 technology, the GFP fluorescent reporter gene was inserted upstream of the Nfil3 start site with a linker sequence (coding for GGSG) in-between, and a loxP site flanked neomycin resistance gene cassette was inserted 411 bp upstream of the Nfil3 coding sequence. The neo cassette was removed through subsequent Cre-mediated recombination. This allele expresses a chimeric GFP-Nfil3 peptide. |
