| Primary Identifier | MGI:7450824 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Srfbp1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAATACCTTTACTGTGGCA and GCTTAATTTTTTAGACTGTG, which resulted in a 4206 bp deletion beginning at Chromosome 18 position 52,483,514 bp and ending after 52,487,719 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000143087 and ENSMUSE00000143081 (exons 4 and 5) and 4052 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 76 and early truncation 191 amino acids later. |
