|  Help  |  About  |  Contact Us

Allele : St6galnac1<em1Len> ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1; endonuclease-mediated mutation 1, Michael J Lenardo

Primary Identifier  MGI:7488215 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  St6galnac1
Is Recombinase  false Is Wild Type  false
molecularNote  Arginine codon 319 (CGA) was changed to glutamine (CAA) (p.R319Q) using an sgRNA (targeting CCGGTATGTTCTCCCTCCGTTGC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of a human mutation associated with inflammatory bowel disease (IBD).
  • mutations:
  • Single point mutation
  • synonyms:
  • St6galnac1<R319Q>,
  • St6galnac1<R319Q>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories