|  Help  |  About  |  Contact Us

Allele : Eprs1<em1Foxp> glutamyl-prolyl-tRNA synthetase 1; endonuclease-mediated mutation 1, Paul L Fox

Primary Identifier  MGI:7539575 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Eprs1
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 32 (last exon) was targeted with an sgRNA (targeting TTCAACCCTCTGTGTGAGCT) using CRISPR/Cas9 technology, resulting in the insertion/duplication of an A (GRCm39:chr1:185160256dup), which leads to a frameshift and premature stop codon (NM_001357474.1:c.4472dup:p.N1491Kfs*5). This mutation disrupts the ZBD domain in the encoded peptide. Transcription, splicing, transcript nuclear export and translation are normal, however, the expressed protein is highly unstable, with ~1/3 of the WT half-life.
  • mutations:
  • Insertion
  • synonyms:
  • Eprs1<deltaZ>,
  • Eprs1<deltaZ>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories