|  Help  |  About  |  Contact Us

Allele : Tgm2<em1Lsan> transglutaminase 2, C polypeptide; endonuclease-mediated mutation 1, Lakshmi Santhanam

Primary Identifier  MGI:7506246 Allele Type  Endonuclease-mediated
Gene  Tgm2 Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  CRISPR/cas9 endonuclease-mediated genome editing uses two guide RNAs [GTGCTGGGTGTTTGCAGCGGTGG and AGTGAAGTACGGGCAGTGCTGGG] to insert the cysteine to serine amino acid substitution in at residue 277 (exon 6). Tgm2 transcript Tgm2-201 was used as reference for the exon numbers and guide sequence (ENSMUSG00000037820).
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Tgm2-C277S,
  • Tgm2-C277S
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories