| Primary Identifier | MGI:7506246 | Allele Type | Endonuclease-mediated |
| Gene | Tgm2 | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | CRISPR/cas9 endonuclease-mediated genome editing uses two guide RNAs [GTGCTGGGTGTTTGCAGCGGTGG and AGTGAAGTACGGGCAGTGCTGGG] to insert the cysteine to serine amino acid substitution in at residue 277 (exon 6). Tgm2 transcript Tgm2-201 was used as reference for the exon numbers and guide sequence (ENSMUSG00000037820). |