| Primary Identifier | MGI:7539427 | Allele Type | Endonuclease-mediated |
| Gene | Daxx | Strain of Origin | C57BL/6N |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Serine codon 226 (TCC) in exon 3 was changed to alanine (GCT) (p.S226A) using an sgRNA (targeting GCGGGCCTCCTGCAAATACG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the histone binding domain of the encoded peptide, affects histone H3.3 binding. |