| Primary Identifier | MGI:7539560 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Lacc1 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Cysteine codon 284 (TGT) in exon 5 was changed to arginine (CGT) (p.C284R) using an sgRNA (targeting GAAGACGATGGGTATACAGTCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation represents the same human mutation (SNP) associated with early-onset Crohnâs disease (CD), ankylosing spondylitis, systemic juvenile idiopathic arthritis and a high-risk state for leprosy. |
