|  Help  |  About  |  Contact Us

Allele : Lacc1<em2Flv> laccase domain containing 1; endonuclease-mediated mutation 2, Richard A Flavell

Primary Identifier  MGI:7539560 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Lacc1
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Cysteine codon 284 (TGT) in exon 5 was changed to arginine (CGT) (p.C284R) using an sgRNA (targeting GAAGACGATGGGTATACAGTCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation represents the same human mutation (SNP) associated with early-onset Crohn’s disease (CD), ankylosing spondylitis, systemic juvenile idiopathic arthritis and a high-risk state for leprosy.
  • mutations:
  • Single point mutation
  • synonyms:
  • Lacc1<C284R>,
  • Lacc1<C284R>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele