|  Help  |  About  |  Contact Us

Allele : Mc4r<em2Mrub> melanocortin 4 receptor; endonuclease-mediated mutation 2, Marcelo Rubinstein

Primary Identifier  MGI:7511844 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Mc4r
Strain of Origin  FVB/NJ Is Recombinase  false
Is Wild Type  false
molecularNote  Isoleucine codon 125 (ATT) in exon 1 was changed to leucine (CTT) (p.I251L) using an sgRNA (GACUCCAAUCAGGAUGGUCA) and an ssODN template with CRISPR/Cas9 technology. This mutation mimics the same human variant associated with protection against obesity and increased adiposity in people of European descent.
  • mutations:
  • Single point mutation
  • synonyms:
  • Mc4r<I251L>,
  • Mc4r<I251L>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories