| Primary Identifier | MGI:7511844 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Mc4r |
| Strain of Origin | FVB/NJ | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Isoleucine codon 125 (ATT) in exon 1 was changed to leucine (CTT) (p.I251L) using an sgRNA (GACUCCAAUCAGGAUGGUCA) and an ssODN template with CRISPR/Cas9 technology. This mutation mimics the same human variant associated with protection against obesity and increased adiposity in people of European descent. |
