| Primary Identifier | MGI:7541265 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Dhx9 |
| Strain of Origin | (C57BL/6 x C3H)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Glycine codon 416 (GGT) in exon 12 was changed to arginine (CGG) (p.G416R) using an sgRNA (targeting GTGATTATCCGAGGGGCTAC) and an ssODN template with CRISPR/Cas9 technology. The mutation represents the human p.G414R mutation found in a patient with a neurodevelopmental disorder. |
