|  Help  |  About  |  Contact Us

Allele : Fnip2<em1Efe> folliculin interacting protein 2; endonuclease-mediated mutation 1, Alejo Efeyan

Primary Identifier  MGI:7541204 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Fnip2
Is Recombinase  false Is Wild Type  false
molecularNote  A T-to-C nucleotide change was engineered in the 3' UTR (GRCm39:chr3:79364590A>G) using an sgRNA (targeting GATAAGTGATATGAATGTAT) and an ssODN template with CRISPR/Cas9 technology. This mutation represents a human T>C mutation (SNP rs2299007) in the 3' UTR that affects miR-181b-5p binding and is associated with metabolic and obesity‐related phenotypes.
  • mutations:
  • Single point mutation
  • synonyms:
  • Fnip2<C>,
  • Fnip2<C>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories